DNA Sequences Multi-species

By: Avatar ai.market
Description
Metadata / QA
Assets / Scripts
Place a Bid

DNA sequence for chimpanzee, dog, and human. Separate files for each sequence.

Example data:

ATGCCCCAACTAAATACCGCCGTATGACCCACCATAATTACCCCCATA
CTCCTGACACTATTTCTCGTCACCCAACTAAAAATATTAAATTCAAAT
TACCATCTACCCCCCTCACCAAAACCCATAAAAATAAAAAACTACAAT
AAACCCTGAGAACCAAAATGAACGAAAATCTATTCGCTTCATTCGCTG
CCCCCACAATCCTAG

Activity

Activity Stats

Views
Votes
Downloads
Models trained

Success!

Bid created and registered with the system.